missing translation for 'onlineSavingsMsg'
Learn More
Learn More
Thermo Scientific™ M13/pUC Sequencing Primer (-46), 22-mer
Thermo Scientific M13/pUC Sequencing Primer (-46), 22-mer is a synthetic single-stranded 22-mer oligonucleotide with free 5'- and 3'-hydroxyl ends.
Marca: Thermo Scientific™ SO114
24.28 EUR valido fino al 2024-11-30
Usa il codice promo "21651" per avere il tuo prezzo promozionale.
Questo articolo non è restituibile.
Consulta la politica di reso
Descrizione
Thermo Scientific M13/pUC Sequencing Primer (-46), 22-mer is a synthetic single-stranded 22-mer oligonucleotide with free 5'- and 3'-hydroxyl ends. This M13/pUC primer anneals to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 μM aqueous solutions.
Applications
• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19 (Cat. No. SM0221), pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR
Primer Sequence: 5'-d(GCCAGGGTTTTCCCAGTCACGA)-3'
Specifica
| Sequencing Primer | |
| Dry Ice | |
| M13 | |
| pUC19, pTZ19R, pTZ57R, M13mp18, pBluescript II | |
| Liquid |
| M13/pUC Sequencing Primer (-46), 22-mer, 10 μM (45 μL) Store at –20°C. |
|
| 10 μM | |
| 45 μL | |
| Sequencing |
For Research Use Only. Not for use in diagnostic procedures.