missing translation for 'onlineSavingsMsg'
Learn More
  1. Home
  2. Products
  3. PCR Equipment and Supplies
  4. Oligonucleotides
  5. 10223130

Thermo Scientific™ SP6 promoter Sequencing Primer, 24-mer

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends.

Marca:  Thermo Scientific™ SO117

28.77 EUR valido fino al 2024-12-31
Usa il codice promo "21651" per avere il tuo prezzo promozionale.

Codice prodotto. 10223130

  • 47.95€ / Pezzo

Effettua il per acquistare questo articolo Hai bisogno di un conto web ? Registrati oggi stesso!

Esplora altre offerte speciali
Questo articolo non è restituibile. Consulta la politica di reso

Descrizione

Descrizione

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. This SP6 Promoter Sequencing Primer, 24-mer is complementary to the SP6 RNA Polymerase promoter region and is supplied as 10 μM aqueous solutions.

Applications
• Sequencing of DNA fragments located downstream from the SP6 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R (Cat. No. SD0141), pTZ57R, and pBluescript II

Promoter Sequence: 5'-d (CATACGATTTAGGTGACACTATAG)-3'

Related products
SP6 promoter Sequencing Primer, 18-mer (SO116)
T7 promoter Sequencing Primer, 20-mer (SO118)
T3 promoter Sequencing Primer, 17-mer (SO119)
T3 promoter Sequencing Primer, 24-mer (SO120)

Notes
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters
• Primers are not phosphorylated

TRUSTED_SUSTAINABILITY
Specifica

Specifica

SP6, T3, T7
SP6 promoter Sequencing Primer, 24-mer, 10 μM (42 μL)

Store at –20°C.
10 μM
10 μM, 42 μL
Sequencing
Sequencing Primer
Dry Ice
SP6
pTZ19R, pTZ57R, pBluescript II
Liquid
Suggerimenti di prodotto

Suggerimenti di prodotto

Videos
SDS
Documenti

Documenti

Certificati
Offerte speciali

Offerte speciali

Correzione del contenuto del prodotto

Fornite il vostro feedback sul contenuto del prodotto compilando il modulo sottostante.

Titolo del prodotto

Facendo clic su Invia, l'utente riconosce che potrebbe essere contattato da Fisher Scientific in merito al feedback fornito in questo modulo. Non condivideremo le vostre informazioni per altri scopi. Tutte le informazioni di contatto fornite saranno conservate in conformità con la nostra Politica sulla privacy. Informativa sulla privacy.

Grazie per averci aiutato a migliorare il nostro sito web. Il vostro feedback è stato inviato

For Research Use Only. Not for use in diagnostic procedures.