Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends.
Marca: Thermo Scientific™ SO117
Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. This SP6 Promoter Sequencing Primer, 24-mer is complementary to the SP6 RNA Polymerase promoter region and is supplied as 10 μM aqueous solutions.
Applications
• Sequencing of DNA fragments located downstream from the SP6 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R (Cat. No. SD0141), pTZ57R, and pBluescript II
Promoter Sequence: 5'-d (CATACGATTTAGGTGACACTATAG)-3'
Related products
SP6 promoter Sequencing Primer, 18-mer (SO116)
T7 promoter Sequencing Primer, 20-mer (SO118)
T3 promoter Sequencing Primer, 17-mer (SO119)
T3 promoter Sequencing Primer, 24-mer (SO120)
Notes
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters
• Primers are not phosphorylated
| SP6, T3, T7 | |
| SP6 promoter Sequencing Primer, 24-mer, 10 μM (42 μL) Store at –20°C. |
|
| 10 μM | |
| 10 μM, 42 μL | |
| Sequencing |
| Sequencing Primer | |
| Dry Ice | |
| SP6 | |
| pTZ19R, pTZ57R, pBluescript II | |
| Liquid |
Catalog No. 11514270
Catalog No. 10580091
Catalog No. 10753741
Fornite il vostro feedback sul contenuto del prodotto compilando il modulo sottostante.
For Research Use Only. Not for use in diagnostic procedures.
