Learn More
Thermo Scientific™ T7 promoter Sequencing Primer, 20-mer
Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends.
Marca: Thermo Scientific™ SO118
Descrizione
Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the T7 RNA Polymarese promoter region. Primers are supplied as 10 µM aqueous solutions.
Applications
• Sequencing of DNA fragments located downstream from the T7 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R (Cat. No. SD0141), pTZ57R, and pBluescript II
Promoter sequences 5'-d (TAATACGACTCACTATAGGG)-3'
Related products
T3 promoter Sequencing Primer, 17-mer (SO119)
SP6 promoter Sequencing Primer, 24-mer (SO117)
T3 promoter Sequencing Primer, 24-mer (SO120)
SP6 promoter Sequencing Primer, 18-mer (SO116)
Notes
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters
• Primers are not phosphorylated.

Specifica
SP6, T3, T7 | |
T7 promoter Sequencing Primer, 20-mer, 10 μM Store at –20°C. |
|
10 μM | |
10 μM | |
Sequencing |
Sequencing Primer | |
Dry Ice | |
T7 | |
pTZ19R, pTZ57R, pBluescript II | |
Liquid |
Suggerimenti di prodotto
Customers who viewed this item also viewed.
Certificati
Per poter ottenere i certificati è necessario indicare un numero di lotto. Per individuare il numero di lotto su ordini precedenti usi l'area dedicata allo stato degli ordini.
Fornite il vostro feedback sul contenuto del prodotto compilando il modulo sottostante.
For Research Use Only. Not for use in diagnostic procedures.