missing translation for 'onlineSavingsMsg'
Learn More
Learn More
Thermo Scientific™ T7 promoter Sequencing Primer, 20-mer
Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends.
Marca: Thermo Scientific™ SO118
24.10 EUR valido fino al 2024-11-30
Usa il codice promo "21651" per avere il tuo prezzo promozionale.
Questo articolo non è restituibile.
Consulta la politica di reso
Descrizione
Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the T7 RNA Polymarese promoter region. Primers are supplied as 10 µM aqueous solutions.
Applications
• Sequencing of DNA fragments located downstream from the T7 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R (Cat. No. SD0141), pTZ57R, and pBluescript II
Promoter sequences 5'-d (TAATACGACTCACTATAGGG)-3'
Related products
T3 promoter Sequencing Primer, 17-mer (SO119)
SP6 promoter Sequencing Primer, 24-mer (SO117)
T3 promoter Sequencing Primer, 24-mer (SO120)
SP6 promoter Sequencing Primer, 18-mer (SO116)
Notes
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters
• Primers are not phosphorylated.
Specifica
| SP6, T3, T7 | |
| T7 promoter Sequencing Primer, 20-mer, 10 μM Store at –20°C. |
|
| 10 μM | |
| pTZ19R, pTZ57R, pBluescript II | |
| Liquid |
| Sequencing Primer | |
| Dry Ice | |
| T7 | |
| Sequencing |
For Research Use Only. Not for use in diagnostic procedures.