Learn More
Thermo Scientific™ M13/pUC Reverse Sequencing Primer (-46), 24-mer
Thermo Scientific M13/pUC Reverse Sequencing Primer (-46), 24-mer is a synthetic single-stranded 24-mer oligonucleotide with free 5'- and 3'-hydroxyl ends.
Marca: Thermo Scientific™ SO115
Descrizione
Thermo Scientific M13/pUC Reverse Sequencing Primer (-46), 24-mer is a synthetic single-stranded 24-mer oligonucleotide with free 5'- and 3'-hydroxyl ends. This M13/pUC primer anneals to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 μM aqueous solutions.
Applications
• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19 (Cat. No. SM0221), pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR
Primer Sequence: 5'-d(GAGCGGATAACAATTTCACACAGG)-3'

Specifica
Sequencing Primer | |
Dry Ice | |
M13 | |
pUC19, pTZ19R, pTZ57R, M13mp18, pBluescript II | |
Liquid |
M13/pUC Reverse Sequencing Primer (-46), 24-mer, 10 μM (42 μL) Store at –20°C. |
|
10 μM | |
10 μM, 42 μL | |
Sequencing |
Suggerimenti di prodotto
Customers who viewed this item also viewed.
Certificati
Per poter ottenere i certificati è necessario indicare un numero di lotto. Per individuare il numero di lotto su ordini precedenti usi l'area dedicata allo stato degli ordini.
Fornite il vostro feedback sul contenuto del prodotto compilando il modulo sottostante.
For Research Use Only. Not for use in diagnostic procedures.