Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends.
Marca: Thermo Scientific™ SO120
Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the T3 RNA Polymerase promoter region and are supplied as 10 µM aqueous solutions.
Applications
• Sequencing of DNA fragments located downstream from the T3 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R (Cat. No. SD0141), pTZ57R, and pBluescript II
Promoter Sequence 5'-d (GCGCGAAATTAACCCTCACTAAAG)-3'
Related products
SP6 promoter Sequencing Primer, 18-mer (SO116)
T3 promoter Sequencing Primer, 17-mer (SO119)
SP6 promoter Sequencing Primer, 24-mer (SO117)
T7 promoter Sequencing Primer, 20-mer (SO118)
Notes
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters
• Primers are not phosphorylated
| SP6, T3, T7 | |
| T3 promoter Sequencing Primer, 24-mer, 10 μM (42 μL) Store at –20°C. |
|
| 10 μM | |
| 10 μM, 42 μL | |
| Liquid |
| Sequencing Primer | |
| Dry Ice | |
| T3 | |
| Sequencing |
Catalog No. 11514270
Catalog No. 10580091
Catalog No. 10753741
Fornite il vostro feedback sul contenuto del prodotto compilando il modulo sottostante.
For Research Use Only. Not for use in diagnostic procedures.
